Genome-wide identification and characterization of long non-coding RNAs

RNA-Seq identifies condition-specific organic signatures of ischemia-reperfusion harm within the human kidney

Background: Acute kidney harm (AKI) is outlined as a sudden occasion of kidney failure or kidney injury inside a brief interval. Ischemia-reperfusion harm (IRI) is a vital issue related to extreme AKI and end-stage kidney illness (ESKD).

 

Nevertheless, the organic mechanisms underlying ischemia and reperfusion are incompletely understood, owing to the complexity of those pathophysiological processes. We aimed to research the important thing organic pathways individually affected by ischemia and reperfusion on the transcriptome stage.

 

Outcomes: 

• We analyzed the steady-state gene expression sample of human kidney tissues from regular (pre-ischemia), ischemia, and reperfusion situations utilizing RNA-sequencing. Standard differential expression and self-organizing map (SOM) clustering analyses adopted by pathway evaluation have been carried out. Differential expression evaluation revealed the metabolic pathways dysregulated in ischemia. Mobile meeting, growth and migration, and immune response-related pathways have been dysregulated in reperfusion.

 

• SOM clustering evaluation highlighted the ischemia-mediated important dysregulation in metabolism, apoptosis, and fibrosis-related pathways, whereas cell development, migration, and immune response-related pathways have been extremely dysregulated by reperfusion after ischemia. The expression of pro-apoptotic genes and loss of life receptors was downregulated throughout ischemia, indicating the existence of a protecting mechanism towards ischemic harm.

 

• Reperfusion induced alterations within the expression of the genes related to immune response similar to inflammasome and antigen representing genes. Additional, the genes associated to cell development and migration, similar to AKT, KRAS, and people associated to Rho signaling, have been downregulated, suggestive of harm responses throughout reperfusion. Semaphorin 4D and plexin B1 ranges have been additionally downregulated.

 

 

Conclusions: We present that particular organic pathways have been distinctively concerned in ischemia and reperfusion throughout IRI, indicating that condition-specific therapeutic methods could also be crucial to stop extreme kidney injury after IRI within the scientific setting.

 

GNAS antibody
70R-5756	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-21619	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody
ABD7068	Lifescience Market	100 ug	EUR 438

GNAS Antibody
ABD7388	Lifescience Market	100 ug	EUR 438

GNAS antibody
38452-100ul	SAB	100ul	EUR 252

GNAS Antibody
32899-100ul	SAB	100ul	EUR 252

GNAS antibody
70R-12940	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-13520	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-1643	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-1651	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody
70R-1652	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody
DF7068	Affbiotech	200ul	EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
DF7388	Affbiotech	200ul	EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
1-CSB-PA352389LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody
1-CSB-PA247539	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody
1-CSB-PA307619LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody
1-CSB-PA009596GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody
1-CSB-PA147947	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS complex locus (GNAS) polyclonal antibody
ABP-PAB-11314	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

GNAS Complex Locus (GNAS) Antibody (HRP)
20-abx337231	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)
20-abx337232	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)
20-abx337233	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Conjugated Antibody
C32899	SAB	100ul	EUR 397

anti- GNAS antibody
FNab03536	FN Test	100µg	EUR 505.25
Immunogen: GNAS complex locus Uniprot ID: O95467 Gene ID: 2778 Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

GNAS Antibody (HRP)
20-abx306647	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Antibody (FITC)
20-abx306648	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Antibody (Biotin)
20-abx306649	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NESP55,GNAS Antibody
abx235663-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

GNAS Polyclonal Antibody
A64422	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GNAS Polyclonal Antibody
A68803	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

Anti-GNAS antibody
PAab03536	Lifescience Market	100 ug	EUR 355

Anti-GNAS antibody
STJ72252	St John's Laboratory	100 µg	EUR 359

Anti-GNAS antibody
STJ23816	St John's Laboratory	100 µl	EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody
STJ27492	St John's Laboratory	100 µl	EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Gnas/ Rat Gnas ELISA Kit
ELI-12714r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-27931r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-35065r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-47242r	Lifescience Market	96 Tests	EUR 886

GNAS siRNA
20-abx900009	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx900030	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918154	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918155	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918156	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918157	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918158	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918159	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918160	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918161	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pBluescriptR-GNAS
PVT17793	Lifescience Market	2 ug	EUR 231

Polyclonal GNAS Antibody (Center)
APR05815G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

anti- NESP55,GNAS antibody
FNab05663	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:50-1：500 Immunogen: GNAS complex locus Uniprot ID: O95467 Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

GNAS Antibody, HRP conjugated
1-CSB-PA352389LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA352389LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated
1-CSB-PA352389LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated
1-CSB-PA307619LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA307619LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated
1-CSB-PA307619LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal GNAS Antibody (aa385-394)
APR02185G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (N-Term)
AMM04827G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)
APG00677G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (C-term)
APR04328G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5
AMM03034G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7
AMM03035G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

GNAS Polyclonal Antibody, HRP Conjugated
A64423	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated
A64424	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated
A64425	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNAS Polyclonal Antibody, HRP Conjugated
A68804	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated
A68805	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated
A68806	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

GNAS cloning plasmid
CSB-CL009596HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1185 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid
CSB-CL009596HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1188 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb
A5546-100ul	Abclonal	100 ul	EUR 308

GNAS Rabbit pAb
A5546-200ul	Abclonal	200 ul	EUR 459

GNAS Rabbit pAb
A5546-20ul	Abclonal	20 ul	EUR 183

GNAS Rabbit pAb
A5546-50ul	Abclonal	50 ul	EUR 223

GNAS Rabbit pAb
A2732-100ul	Abclonal	100 ul	EUR 308

GNAS Rabbit pAb
A2732-200ul	Abclonal	200 ul	EUR 459

GNAS Rabbit pAb
A2732-20ul	Abclonal	20 ul	EUR 183

GNAS Rabbit pAb
A2732-50ul	Abclonal	50 ul	EUR 223

GNAS Blocking Peptide
33R-6814	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide
33R-10097	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide
33R-9925	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide
33R-8471	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide
DF7068-BP	Affbiotech	1mg	EUR 195

GNAS Blocking Peptide
DF7388-BP	Affbiotech	1mg	EUR 195

Recombinant human GNAS
P1012	FN Test	100ug	Ask for price
Uniprot ID: O95467 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m
PVT11671	Lifescience Market	2 ug	EUR 273

Rat GNAS shRNA Plasmid
20-abx984695	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid
20-abx984696	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS ELISA KIT
ELI-12712h	Lifescience Market	96 Tests	EUR 824

Mouse Gnas ELISA KIT
ELI-12713m	Lifescience Market	96 Tests	EUR 865

Canine GNAS ELISA KIT
ELI-27250d	Lifescience Market	96 Tests	EUR 928

GNAS ELISA KIT|Human
EF009911	Lifescience Market	96 Tests	EUR 689

Mouse Gnas ELISA KIT
ELI-48020m	Lifescience Market	96 Tests	EUR 865

Human GNAS ELISA KIT
ELI-48772h	Lifescience Market	96 Tests	EUR 824

Bovine GNAS ELISA KIT
ELI-38027b	Lifescience Market	96 Tests	EUR 928

Mouse GNAS shRNA Plasmid
20-abx970580	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970581	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970582	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970583	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951847	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951849	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951850	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NESP55/GNAS ELISA KIT|Human
EF001179	Lifescience Market	96 Tests	EUR 689

GNAS ORF Vector (Human) (pORF)
ORF004496	ABM	1.0 ug DNA	EUR 95

GNAS ORF Vector (Human) (pORF)
ORF004497	ABM	1.0 ug DNA	EUR 95

Gnas ORF Vector (Rat) (pORF)
ORF067655	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067656	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067657	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067658	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067659	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046308	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046309	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046310	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046311	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046312	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046313	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046314	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046315	ABM	1.0 ug DNA	EUR 506

A mouse tissue atlas of small noncoding RNA

 

Small noncoding RNAs (ncRNAs) play a significant position in a broad vary of organic processes each in well being and illness. A complete quantitative reference of small ncRNA expression would considerably advance our understanding of ncRNA roles in shaping tissue capabilities. Right here, we systematically profiled the degrees of 5 ncRNA courses (microRNA [miRNA], small nucleolar RNA [snoRNA], small nuclear RNA [snRNA], small Cajal body-specific RNA [scaRNA], and switch RNA [tRNA] fragments) throughout 11 mouse tissues by deep sequencing.

Utilizing 14 organic replicates spanning each sexes, we recognized that ∼30% of small ncRNAs are distributed throughout the physique in a tissue-specific method with some additionally being sexually dimorphic. We discovered that some miRNAs are topic to “arm switching” between wholesome tissues and that tRNA fragments are retained inside tissues in each a gene- and a tissue-specific method.

Out of 11 profiled tissues, we confirmed that mind incorporates the biggest variety of distinctive small ncRNA transcripts, a few of which have been beforehand annotated whereas others are recognized on this research. Moreover, by combining these findings with single-cell chromatin accessibility (scATAC-seq) information, we have been in a position to join recognized brain-specific ncRNAs with their cell forms of origin. These outcomes yield essentially the most complete characterization of particular and ubiquitous small RNAs in particular person murine tissues up to now, and we count on that these information can be a useful resource for the additional identification of ncRNAs concerned in tissue perform in well being and dysfunction in illness.

 

Genome-wide identification and characterization of lengthy non-coding RNAs in Tribolium castaneum

 

Lengthy non-coding RNAs (lncRNAs) are poorly understood in bugs. On this research, we carried out genome-wide evaluation of lncRNAs in Tribolium castaneum by RNA-seq. In complete, 4516 lncRNA transcripts akin to 3917 genes have been recognized from late embryos, early larvae, late larvae, early pupae, late pupae and early adults of T. castaneum, together with 3152 novel lncRNAs and 1364 identified lncRNAs. These lncRNAs have few exons and transcripts, and are brief in size.

Throughout growth, they exhibited 9 totally different expression patterns. Functionally, they’ll act both by concentrating on messenger RNAs (1813 lncRNAs) and lncRNAs (45 lncRNAs) or as micro RNA (miRNA) precursors (46 lncRNAs). LncRNAs have been noticed to focus on the metabolic enzymes of glycolysis, TCA cycle and amino acids, demonstrating that lncRNAs management metabolism by regulating metabolic enzymes.

Furthermore, lncRNAs have been proven to take part in cell differentiation and growth by way of their targets. As miRNA precursors, lncRNAs may take part within the ecdysone signaling pathway. This research supplies complete info for lncRNAs of T. castaneum, and can promote useful evaluation and goal identification of lncRNAs within the insect.

GNAS antibody
70R-21619	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody
ABD7068	Lifescience Market	100 ug	EUR 438

GNAS Antibody
ABD7388	Lifescience Market	100 ug	EUR 438

GNAS antibody
38452-100ul	SAB	100ul	EUR 252

GNAS Antibody
32899-100ul	SAB	100ul	EUR 252

GNAS antibody
70R-12940	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-13520	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-1643	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-1651	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody
70R-1652	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody
DF7068	Affbiotech	200ul	EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
DF7388	Affbiotech	200ul	EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
1-CSB-PA352389LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody
1-CSB-PA247539	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody
1-CSB-PA307619LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody
1-CSB-PA009596GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody
1-CSB-PA147947	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS complex locus (GNAS) polyclonal antibody
ABP-PAB-11314	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

GNAS Complex Locus (GNAS) Antibody (HRP)
20-abx337231	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)
20-abx337232	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)
20-abx337233	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Conjugated Antibody
C32899	SAB	100ul	EUR 397

anti- GNAS antibody
FNab03536	FN Test	100µg	EUR 505.25
Immunogen: GNAS complex locus Uniprot ID: O95467 Gene ID: 2778 Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

GNAS Antibody (HRP)
20-abx306647	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Antibody (FITC)
20-abx306648	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Antibody (Biotin)
20-abx306649	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NESP55,GNAS Antibody
abx235663-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

GNAS Polyclonal Antibody
A64422	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GNAS Polyclonal Antibody
A68803	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

Anti-GNAS antibody
PAab03536	Lifescience Market	100 ug	EUR 355

Anti-GNAS antibody
STJ72252	St John's Laboratory	100 µg	EUR 359

Anti-GNAS antibody
STJ23816	St John's Laboratory	100 µl	EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody
STJ27492	St John's Laboratory	100 µl	EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Gnas/ Rat Gnas ELISA Kit
ELI-12714r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-27931r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-35065r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-47242r	Lifescience Market	96 Tests	EUR 886

GNAS siRNA
20-abx900009	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx900030	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918154	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918155	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918156	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918157	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918158	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918159	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918160	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918161	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pBluescriptR-GNAS
PVT17793	Lifescience Market	2 ug	EUR 231

Polyclonal GNAS Antibody (Center)
APR05815G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

anti- NESP55,GNAS antibody
FNab05663	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:50-1：500 Immunogen: GNAS complex locus Uniprot ID: O95467 Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

GNAS Antibody, HRP conjugated
1-CSB-PA352389LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA352389LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated
1-CSB-PA352389LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated
1-CSB-PA307619LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA307619LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated
1-CSB-PA307619LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal GNAS Antibody (aa385-394)
APR02185G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (N-Term)
AMM04827G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)
APG00677G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (C-term)
APR04328G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5
AMM03034G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7
AMM03035G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

GNAS Polyclonal Antibody, HRP Conjugated
A64423	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated
A64424	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated
A64425	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNAS Polyclonal Antibody, HRP Conjugated
A68804	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated
A68805	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated
A68806	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

GNAS cloning plasmid
CSB-CL009596HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1185 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid
CSB-CL009596HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1188 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb
A5546-100ul	Abclonal	100 ul	EUR 308

GNAS Rabbit pAb
A5546-200ul	Abclonal	200 ul	EUR 459

GNAS Rabbit pAb
A5546-20ul	Abclonal	20 ul	EUR 183

GNAS Rabbit pAb
A5546-50ul	Abclonal	50 ul	EUR 223

GNAS Rabbit pAb
A2732-100ul	Abclonal	100 ul	EUR 308

GNAS Rabbit pAb
A2732-200ul	Abclonal	200 ul	EUR 459

GNAS Rabbit pAb
A2732-20ul	Abclonal	20 ul	EUR 183

GNAS Rabbit pAb
A2732-50ul	Abclonal	50 ul	EUR 223

GNAS Blocking Peptide
33R-6814	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide
33R-10097	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide
33R-9925	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide
33R-8471	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide
DF7068-BP	Affbiotech	1mg	EUR 195

GNAS Blocking Peptide
DF7388-BP	Affbiotech	1mg	EUR 195

Recombinant human GNAS
P1012	FN Test	100ug	Ask for price
Uniprot ID: O95467 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m
PVT11671	Lifescience Market	2 ug	EUR 273

Rat GNAS shRNA Plasmid
20-abx984695	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid
20-abx984696	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS ELISA KIT
ELI-12712h	Lifescience Market	96 Tests	EUR 824

Mouse Gnas ELISA KIT
ELI-12713m	Lifescience Market	96 Tests	EUR 865

Canine GNAS ELISA KIT
ELI-27250d	Lifescience Market	96 Tests	EUR 928

GNAS ELISA KIT|Human
EF009911	Lifescience Market	96 Tests	EUR 689

Mouse Gnas ELISA KIT
ELI-48020m	Lifescience Market	96 Tests	EUR 865

Human GNAS ELISA KIT
ELI-48772h	Lifescience Market	96 Tests	EUR 824

Bovine GNAS ELISA KIT
ELI-38027b	Lifescience Market	96 Tests	EUR 928

Mouse GNAS shRNA Plasmid
20-abx970580	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970581	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970582	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970583	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951847	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951849	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951850	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NESP55/GNAS ELISA KIT|Human
EF001179	Lifescience Market	96 Tests	EUR 689

GNAS ORF Vector (Human) (pORF)
ORF004496	ABM	1.0 ug DNA	EUR 95

GNAS ORF Vector (Human) (pORF)
ORF004497	ABM	1.0 ug DNA	EUR 95

Gnas ORF Vector (Rat) (pORF)
ORF067655	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067656	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067657	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067658	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Rat) (pORF)
ORF067659	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046308	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046309	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046310	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046311	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046312	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046313	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046314	ABM	1.0 ug DNA	EUR 506

Gnas ORF Vector (Mouse) (pORF)
ORF046315	ABM	1.0 ug DNA	EUR 506

GNAS ELISA Kit (Human) (OKCA01388)
OKCA01388	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

GNAS ELISA Kit (Rat) (OKCA01910)
OKCA01910	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) function as transducers in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). Signaling involves the activation of adenylyl cyclases, resulting in increased levels of the signaling molecule cAMP. GNAS functions downstream of several GPCRs, including beta-adrenergic receptors. XLas isoforms interact with the same set of receptors as Gnas isoforms.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

GNAS ELISA Kit (Human) (OKEH08012)
OKEH08012	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128ng/mL

GNAS ELISA Kit (Human) (OKWB00174)
OKWB00174	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) function as transducers in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). Signaling involves the activation of adenylyl cyclases, resulting in increased levels of the signaling molecule cAMP. GNAS functions downstream of several GPCRs, including beta-adrenergic receptors. Stimulates the Ras signaling pathway via RAPGEF2.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 nmol/mL

Mouse Protein ALEX, Gnas ELISA KIT
ELI-24352m	Lifescience Market	96 Tests	EUR 865

Human Protein ALEX, GNAS ELISA KIT
ELI-24547h	Lifescience Market	96 Tests	EUR 824

GNAS sgRNA CRISPR Lentivector set (Human)
K0875301	ABM	3 x 1.0 ug	EUR 339

Gnas sgRNA CRISPR Lentivector set (Mouse)
K4363501	ABM	3 x 1.0 ug	EUR 339

Gnas sgRNA CRISPR Lentivector set (Rat)
K7535001	ABM	3 x 1.0 ug	EUR 339

GNAS-AS1 ORF Vector (Human) (pORF)
ORF020250	ABM	1.0 ug DNA	EUR 95

pECMV-3脳FLAG-GNAS vector
PVT12057	Lifescience Market	2 ug	EUR 352

GNAS sgRNA CRISPR Lentivector (Human) (Target 1)
K0875302	ABM	1.0 ug DNA	EUR 154

GNAS sgRNA CRISPR Lentivector (Human) (Target 2)
K0875303	ABM	1.0 ug DNA	EUR 154

GNAS sgRNA CRISPR Lentivector (Human) (Target 3)
K0875304	ABM	1.0 ug DNA	EUR 154

Human Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx387603-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392277-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392284-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4363502	ABM	1.0 ug DNA	EUR 154

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4363503	ABM	1.0 ug DNA	EUR 154

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4363504	ABM	1.0 ug DNA	EUR 154

Gnas sgRNA CRISPR Lentivector (Rat) (Target 1)
K7535002	ABM	1.0 ug DNA	EUR 154

Gnas sgRNA CRISPR Lentivector (Rat) (Target 2)
K7535003	ABM	1.0 ug DNA	EUR 154

Gnas sgRNA CRISPR Lentivector (Rat) (Target 3)
K7535004	ABM	1.0 ug DNA	EUR 154

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185230	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185231	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185232	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185233	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185234	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185235	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185236	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185237	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185238	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185239	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185240	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185241	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185242	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185243	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185244	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185245	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185246	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185247	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185248	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185249	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185250	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185251	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185252	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185253	ABM	500 ng	EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185254	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185255	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185256	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185257	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185258	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185259	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185260	ABM	500 ng	EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185261	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPB-C-His)
PV270618	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPB-N-His)
PV270619	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270620	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPM-C-His)
PV270621	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPB-C-His)
PV270622	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPB-N-His)
PV270623	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270624	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPM-C-His)
PV270625	ABM	500 ng	EUR 603

GNAS Protein Vector (Rat) (pPB-C-His)
PV270626	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPB-N-His)
PV270627	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270628	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPM-C-His)
PV270629	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPB-C-His)
PV270630	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPB-N-His)
PV270631	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270632	ABM	500 ng	EUR 1166

GNAS Protein Vector (Rat) (pPM-C-His)
PV270633	ABM	500 ng	EUR 1166