Genome-wide identification and characterization of long non-coding RNAs


RNA-Seq identifies condition-specific organic signatures of ischemia-reperfusion harm within the human kidney

Background: Acute kidney harm (AKI) is outlined as a sudden occasion of kidney failure or kidney injury inside a brief interval. Ischemia-reperfusion harm (IRI) is a vital issue related to extreme AKI and end-stage kidney illness (ESKD).


Nevertheless, the organic mechanisms underlying ischemia and reperfusion are incompletely understood, owing to the complexity of those pathophysiological processes. We aimed to research the important thing organic pathways individually affected by ischemia and reperfusion on the transcriptome stage.



  • We analyzed the steady-state gene expression sample of human kidney tissues from regular (pre-ischemia), ischemia, and reperfusion situations utilizing RNA-sequencing. Standard differential expression and self-organizing map (SOM) clustering analyses adopted by pathway evaluation have been carried out. Differential expression evaluation revealed the metabolic pathways dysregulated in ischemia. Mobile meeting, growth and migration, and immune response-related pathways have been dysregulated in reperfusion.


  • SOM clustering evaluation highlighted the ischemia-mediated important dysregulation in metabolism, apoptosis, and fibrosis-related pathways, whereas cell development, migration, and immune response-related pathways have been extremely dysregulated by reperfusion after ischemia. The expression of pro-apoptotic genes and loss of life receptors was downregulated throughout ischemia, indicating the existence of a protecting mechanism towards ischemic harm.


  • Reperfusion induced alterations within the expression of the genes related to immune response similar to inflammasome and antigen representing genes. Additional, the genes associated to cell development and migration, similar to AKT, KRAS, and people associated to Rho signaling, have been downregulated, suggestive of harm responses throughout reperfusion. Semaphorin 4D and plexin B1 ranges have been additionally downregulated.



Conclusions: We present that particular organic pathways have been distinctively concerned in ischemia and reperfusion throughout IRI, indicating that condition-specific therapeutic methods could also be crucial to stop extreme kidney injury after IRI within the scientific setting.




GNAS antibody

70R-5756 50 ug
EUR 467
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-21619 50 ul
EUR 435
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody

ABD7068 100 ug
EUR 438

GNAS Antibody

ABD7388 100 ug
EUR 438

GNAS antibody

38452-100ul 100ul
EUR 252

GNAS Antibody

32899-100ul 100ul
EUR 252

GNAS antibody

70R-12940 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-13520 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-1643 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-1651 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody

70R-1652 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody

DF7068 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

DF7388 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS complex locus (GNAS) polyclonal antibody

ABP-PAB-11314 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

GNAS Complex Locus (GNAS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Conjugated Antibody

C32899 100ul
EUR 397

anti- GNAS antibody

FNab03536 100µg
EUR 505.25
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Gene ID: 2778
  • Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

GNAS Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NESP55,GNAS Antibody

abx235663-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GNAS Polyclonal Antibody

A64422 100 µg
EUR 570.55
Description: The best epigenetics products

GNAS Polyclonal Antibody

A68803 100 ?g
EUR 628.55
Description: Ask the seller for details

Anti-GNAS antibody

PAab03536 100 ug
EUR 355

Anti-GNAS antibody

STJ72252 100 µg
EUR 359

Anti-GNAS antibody

STJ23816 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody

STJ27492 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Gnas/ Rat Gnas ELISA Kit

ELI-12714r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-27931r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-35065r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-47242r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17793 2 ug
EUR 231

Polyclonal GNAS Antibody (Center)

APR05815G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

anti- NESP55,GNAS antibody

FNab05663 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

GNAS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal GNAS Antibody (aa385-394)

APR02185G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (N-Term)

AMM04827G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)

APG00677G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (C-term)

APR04328G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5

AMM03034G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7

AMM03035G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

GNAS Polyclonal Antibody, HRP Conjugated

A64423 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated

A64424 100 µg
EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated

A64425 100 µg
EUR 570.55
Description: reagents widely cited

GNAS Polyclonal Antibody, HRP Conjugated

A68804 100 ?g
EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated

A68805 100 ?g
EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated

A68806 100 ?g
EUR 628.55
Description: fast delivery possible

GNAS cloning plasmid

CSB-CL009596HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid

CSB-CL009596HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1188
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb

A5546-100ul 100 ul
EUR 308

GNAS Rabbit pAb

A5546-200ul 200 ul
EUR 459

GNAS Rabbit pAb

A5546-20ul 20 ul
EUR 183

GNAS Rabbit pAb

A5546-50ul 50 ul
EUR 223

GNAS Rabbit pAb

A2732-100ul 100 ul
EUR 308

GNAS Rabbit pAb

A2732-200ul 200 ul
EUR 459

GNAS Rabbit pAb

A2732-20ul 20 ul
EUR 183

GNAS Rabbit pAb

A2732-50ul 50 ul
EUR 223

GNAS Blocking Peptide

33R-6814 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide

33R-10097 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide

33R-9925 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide

33R-8471 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide

DF7068-BP 1mg
EUR 195

GNAS Blocking Peptide

DF7388-BP 1mg
EUR 195

Recombinant human GNAS

P1012 100ug Ask for price
  • Uniprot ID: O95467
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m

PVT11671 2 ug
EUR 273

Rat GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-12712h 96 Tests
EUR 824

Mouse Gnas ELISA KIT

ELI-12713m 96 Tests
EUR 865


ELI-27250d 96 Tests
EUR 928


EF009911 96 Tests
EUR 689

Mouse Gnas ELISA KIT

ELI-48020m 96 Tests
EUR 865


ELI-48772h 96 Tests
EUR 824


ELI-38027b 96 Tests
EUR 928

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001179 96 Tests
EUR 689

GNAS ORF Vector (Human) (pORF)

ORF004496 1.0 ug DNA
EUR 95

GNAS ORF Vector (Human) (pORF)

ORF004497 1.0 ug DNA
EUR 95

Gnas ORF Vector (Rat) (pORF)

ORF067655 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067656 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067657 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067658 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067659 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046308 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046309 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046310 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046311 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046312 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046313 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046314 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046315 1.0 ug DNA
EUR 506

A mouse tissue atlas of small noncoding RNA


Small noncoding RNAs (ncRNAs) play a significant position in a broad vary of organic processes each in well being and illness. A complete quantitative reference of small ncRNA expression would considerably advance our understanding of ncRNA roles in shaping tissue capabilities. Right here, we systematically profiled the degrees of 5 ncRNA courses (microRNA [miRNA], small nucleolar RNA [snoRNA], small nuclear RNA [snRNA], small Cajal body-specific RNA [scaRNA], and switch RNA [tRNA] fragments) throughout 11 mouse tissues by deep sequencing.

Utilizing 14 organic replicates spanning each sexes, we recognized that ∼30% of small ncRNAs are distributed throughout the physique in a tissue-specific method with some additionally being sexually dimorphic. We discovered that some miRNAs are topic to “arm switching” between wholesome tissues and that tRNA fragments are retained inside tissues in each a gene- and a tissue-specific method.

Out of 11 profiled tissues, we confirmed that mind incorporates the biggest variety of distinctive small ncRNA transcripts, a few of which have been beforehand annotated whereas others are recognized on this research. Moreover, by combining these findings with single-cell chromatin accessibility (scATAC-seq) information, we have been in a position to join recognized brain-specific ncRNAs with their cell forms of origin. These outcomes yield essentially the most complete characterization of particular and ubiquitous small RNAs in particular person murine tissues up to now, and we count on that these information can be a useful resource for the additional identification of ncRNAs concerned in tissue perform in well being and dysfunction in illness.


Genome-wide identification and characterization of lengthy non-coding RNAs in Tribolium castaneum


Lengthy non-coding RNAs (lncRNAs) are poorly understood in bugs. On this research, we carried out genome-wide evaluation of lncRNAs in Tribolium castaneum by RNA-seq. In complete, 4516 lncRNA transcripts akin to 3917 genes have been recognized from late embryos, early larvae, late larvae, early pupae, late pupae and early adults of T. castaneum, together with 3152 novel lncRNAs and 1364 identified lncRNAs. These lncRNAs have few exons and transcripts, and are brief in size.

Throughout growth, they exhibited 9 totally different expression patterns. Functionally, they’ll act both by concentrating on messenger RNAs (1813 lncRNAs) and lncRNAs (45 lncRNAs) or as micro RNA (miRNA) precursors (46 lncRNAs). LncRNAs have been noticed to focus on the metabolic enzymes of glycolysis, TCA cycle and amino acids, demonstrating that lncRNAs management metabolism by regulating metabolic enzymes.

Furthermore, lncRNAs have been proven to take part in cell differentiation and growth by way of their targets. As miRNA precursors, lncRNAs may take part within the ecdysone signaling pathway. This research supplies complete info for lncRNAs of T. castaneum, and can promote useful evaluation and goal identification of lncRNAs within the insect.

GNAS antibody

70R-21619 50 ul
EUR 435
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody

ABD7068 100 ug
EUR 438

GNAS Antibody

ABD7388 100 ug
EUR 438

GNAS antibody

38452-100ul 100ul
EUR 252

GNAS Antibody

32899-100ul 100ul
EUR 252

GNAS antibody

70R-12940 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-13520 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-1643 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-1651 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody

70R-1652 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody

DF7068 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

DF7388 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS complex locus (GNAS) polyclonal antibody

ABP-PAB-11314 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

GNAS Complex Locus (GNAS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Conjugated Antibody

C32899 100ul
EUR 397

anti- GNAS antibody

FNab03536 100µg
EUR 505.25
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Gene ID: 2778
  • Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

GNAS Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NESP55,GNAS Antibody

abx235663-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GNAS Polyclonal Antibody

A64422 100 µg
EUR 570.55
Description: The best epigenetics products

GNAS Polyclonal Antibody

A68803 100 ?g
EUR 628.55
Description: Ask the seller for details

Anti-GNAS antibody

PAab03536 100 ug
EUR 355

Anti-GNAS antibody

STJ72252 100 µg
EUR 359

Anti-GNAS antibody

STJ23816 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody

STJ27492 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Gnas/ Rat Gnas ELISA Kit

ELI-12714r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-27931r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-35065r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-47242r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17793 2 ug
EUR 231

Polyclonal GNAS Antibody (Center)

APR05815G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

anti- NESP55,GNAS antibody

FNab05663 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

GNAS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal GNAS Antibody (aa385-394)

APR02185G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (N-Term)

AMM04827G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)

APG00677G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (C-term)

APR04328G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5

AMM03034G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7

AMM03035G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

GNAS Polyclonal Antibody, HRP Conjugated

A64423 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated

A64424 100 µg
EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated

A64425 100 µg
EUR 570.55
Description: reagents widely cited

GNAS Polyclonal Antibody, HRP Conjugated

A68804 100 ?g
EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated

A68805 100 ?g
EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated

A68806 100 ?g
EUR 628.55
Description: fast delivery possible

GNAS cloning plasmid

CSB-CL009596HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid

CSB-CL009596HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1188
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb

A5546-100ul 100 ul
EUR 308

GNAS Rabbit pAb

A5546-200ul 200 ul
EUR 459

GNAS Rabbit pAb

A5546-20ul 20 ul
EUR 183

GNAS Rabbit pAb

A5546-50ul 50 ul
EUR 223

GNAS Rabbit pAb

A2732-100ul 100 ul
EUR 308

GNAS Rabbit pAb

A2732-200ul 200 ul
EUR 459

GNAS Rabbit pAb

A2732-20ul 20 ul
EUR 183

GNAS Rabbit pAb

A2732-50ul 50 ul
EUR 223

GNAS Blocking Peptide

33R-6814 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide

33R-10097 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide

33R-9925 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide

33R-8471 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide

DF7068-BP 1mg
EUR 195

GNAS Blocking Peptide

DF7388-BP 1mg
EUR 195

Recombinant human GNAS

P1012 100ug Ask for price
  • Uniprot ID: O95467
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m

PVT11671 2 ug
EUR 273

Rat GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-12712h 96 Tests
EUR 824

Mouse Gnas ELISA KIT

ELI-12713m 96 Tests
EUR 865


ELI-27250d 96 Tests
EUR 928


EF009911 96 Tests
EUR 689

Mouse Gnas ELISA KIT

ELI-48020m 96 Tests
EUR 865


ELI-48772h 96 Tests
EUR 824


ELI-38027b 96 Tests
EUR 928

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001179 96 Tests
EUR 689

GNAS ORF Vector (Human) (pORF)

ORF004496 1.0 ug DNA
EUR 95

GNAS ORF Vector (Human) (pORF)

ORF004497 1.0 ug DNA
EUR 95

Gnas ORF Vector (Rat) (pORF)

ORF067655 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067656 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067657 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067658 1.0 ug DNA
EUR 506

Gnas ORF Vector (Rat) (pORF)

ORF067659 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046308 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046309 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046310 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046311 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046312 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046313 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046314 1.0 ug DNA
EUR 506

Gnas ORF Vector (Mouse) (pORF)

ORF046315 1.0 ug DNA
EUR 506

GNAS ELISA Kit (Human) (OKCA01388)

OKCA01388 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

GNAS ELISA Kit (Rat) (OKCA01910)

OKCA01910 96 Wells
EUR 846
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) function as transducers in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). Signaling involves the activation of adenylyl cyclases, resulting in increased levels of the signaling molecule cAMP. GNAS functions downstream of several GPCRs, including beta-adrenergic receptors. XLas isoforms interact with the same set of receptors as Gnas isoforms.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

GNAS ELISA Kit (Human) (OKEH08012)

OKEH08012 96 Wells
EUR 896
Description: Description of target: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128ng/mL

GNAS ELISA Kit (Human) (OKWB00174)

OKWB00174 96 Wells
EUR 572
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) function as transducers in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). Signaling involves the activation of adenylyl cyclases, resulting in increased levels of the signaling molecule cAMP. GNAS functions downstream of several GPCRs, including beta-adrenergic receptors. Stimulates the Ras signaling pathway via RAPGEF2.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 nmol/mL

Mouse Protein ALEX, Gnas ELISA KIT

ELI-24352m 96 Tests
EUR 865


ELI-24547h 96 Tests
EUR 824

GNAS sgRNA CRISPR Lentivector set (Human)

K0875301 3 x 1.0 ug
EUR 339

Gnas sgRNA CRISPR Lentivector set (Mouse)

K4363501 3 x 1.0 ug
EUR 339

Gnas sgRNA CRISPR Lentivector set (Rat)

K7535001 3 x 1.0 ug
EUR 339

GNAS-AS1 ORF Vector (Human) (pORF)

ORF020250 1.0 ug DNA
EUR 95

pECMV-3脳FLAG-GNAS vector

PVT12057 2 ug
EUR 352

GNAS sgRNA CRISPR Lentivector (Human) (Target 1)

K0875302 1.0 ug DNA
EUR 154

GNAS sgRNA CRISPR Lentivector (Human) (Target 2)

K0875303 1.0 ug DNA
EUR 154

GNAS sgRNA CRISPR Lentivector (Human) (Target 3)

K0875304 1.0 ug DNA
EUR 154

Human Neuroendocrine Secretory Protein (GNAS) ELISA Kit

abx387603-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuroendocrine Secretory Protein (GNAS) ELISA Kit

abx392277-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neuroendocrine Secretory Protein (GNAS) ELISA Kit

abx392284-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4363502 1.0 ug DNA
EUR 154

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4363503 1.0 ug DNA
EUR 154

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4363504 1.0 ug DNA
EUR 154

Gnas sgRNA CRISPR Lentivector (Rat) (Target 1)

K7535002 1.0 ug DNA
EUR 154

Gnas sgRNA CRISPR Lentivector (Rat) (Target 2)

K7535003 1.0 ug DNA
EUR 154

Gnas sgRNA CRISPR Lentivector (Rat) (Target 3)

K7535004 1.0 ug DNA
EUR 154

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185230 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185231 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185232 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185233 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185234 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185235 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185236 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185237 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185238 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185239 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185240 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185241 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185242 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185243 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185244 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185245 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185246 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185247 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185248 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185249 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185250 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185251 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185252 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185253 500 ng
EUR 1065

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185254 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185255 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185256 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185257 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185258 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185259 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185260 500 ng
EUR 603

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185261 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPB-C-His)

PV270618 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPB-N-His)

PV270619 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270620 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPM-C-His)

PV270621 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPB-C-His)

PV270622 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPB-N-His)

PV270623 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270624 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPM-C-His)

PV270625 500 ng
EUR 603

GNAS Protein Vector (Rat) (pPB-C-His)

PV270626 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPB-N-His)

PV270627 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270628 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPM-C-His)

PV270629 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPB-C-His)

PV270630 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPB-N-His)

PV270631 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270632 500 ng
EUR 1166

GNAS Protein Vector (Rat) (pPM-C-His)

PV270633 500 ng
EUR 1166